l bacterium Search Results


sgrna of l. bacterium cas12a  (Bioneer Corporation)
90
Bioneer Corporation sgrna of l. bacterium cas12a
Impact of the IDR length and charge on Cas9 inhibition by AcrIIA5. ( A <t>)</t> <t>DNA</t> cleavage assay of S. pyogenes <t>Cas9−sgRNA</t> (0.5 μM) in the presence of AcrIIA4 (3 μM) and AcrIIA5 (0.25, 0.5, 1 and 3 μM). ( B ) Analysis of sgRNA (0.2 μM) cleavage in the presence and absence of Cas9 (0.4 μM), AcrIIA4 (4 μM) and AcrIIA5 (4 μM) on a urea gel. ( C ) DNA cleavage assay of Cas9−sgRNA (0.5 μM) in the presence of AcrIIA5 (1 μM) or AcrIIA5 Δ20 (1 μM). ( D ) Domain constructs of AcrIIA5 with serial truncations (top) and charge mutations of the IDR (middle), and the IDR peptide sequence (bottom). (E−G) DNA cleavage assay of Cas9−sgRNA (0.5 μM) in the presence of ( E ) AcrIIA5 with serial truncations of IDR (3 μM), ( F ) AcrIIA5 with charge mutations of IDR (3 μM), and ( G ) the isolated IDR peptide (a.a. 1–20; 0.25, 0.5, 1, 3, and 5 μM) of AcrIIA5.
Sgrna Of L. Bacterium Cas12a, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sgrna of l. bacterium cas12a/product/Bioneer Corporation
Average 90 stars, based on 1 article reviews
sgrna of l. bacterium cas12a - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
bacterium l. casei dg  (Biokar Diagnostics Co)
90
Biokar Diagnostics Co bacterium l. casei dg
Impact of the IDR length and charge on Cas9 inhibition by AcrIIA5. ( A <t>)</t> <t>DNA</t> cleavage assay of S. pyogenes <t>Cas9−sgRNA</t> (0.5 μM) in the presence of AcrIIA4 (3 μM) and AcrIIA5 (0.25, 0.5, 1 and 3 μM). ( B ) Analysis of sgRNA (0.2 μM) cleavage in the presence and absence of Cas9 (0.4 μM), AcrIIA4 (4 μM) and AcrIIA5 (4 μM) on a urea gel. ( C ) DNA cleavage assay of Cas9−sgRNA (0.5 μM) in the presence of AcrIIA5 (1 μM) or AcrIIA5 Δ20 (1 μM). ( D ) Domain constructs of AcrIIA5 with serial truncations (top) and charge mutations of the IDR (middle), and the IDR peptide sequence (bottom). (E−G) DNA cleavage assay of Cas9−sgRNA (0.5 μM) in the presence of ( E ) AcrIIA5 with serial truncations of IDR (3 μM), ( F ) AcrIIA5 with charge mutations of IDR (3 μM), and ( G ) the isolated IDR peptide (a.a. 1–20; 0.25, 0.5, 1, 3, and 5 μM) of AcrIIA5.
Bacterium L. Casei Dg, supplied by Biokar Diagnostics Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bacterium l. casei dg/product/Biokar Diagnostics Co
Average 90 stars, based on 1 article reviews
bacterium l. casei dg - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
bacterium l. reuteri  (BioGaia Inc)
90
BioGaia Inc bacterium l. reuteri
Impact of the IDR length and charge on Cas9 inhibition by AcrIIA5. ( A <t>)</t> <t>DNA</t> cleavage assay of S. pyogenes <t>Cas9−sgRNA</t> (0.5 μM) in the presence of AcrIIA4 (3 μM) and AcrIIA5 (0.25, 0.5, 1 and 3 μM). ( B ) Analysis of sgRNA (0.2 μM) cleavage in the presence and absence of Cas9 (0.4 μM), AcrIIA4 (4 μM) and AcrIIA5 (4 μM) on a urea gel. ( C ) DNA cleavage assay of Cas9−sgRNA (0.5 μM) in the presence of AcrIIA5 (1 μM) or AcrIIA5 Δ20 (1 μM). ( D ) Domain constructs of AcrIIA5 with serial truncations (top) and charge mutations of the IDR (middle), and the IDR peptide sequence (bottom). (E−G) DNA cleavage assay of Cas9−sgRNA (0.5 μM) in the presence of ( E ) AcrIIA5 with serial truncations of IDR (3 μM), ( F ) AcrIIA5 with charge mutations of IDR (3 μM), and ( G ) the isolated IDR peptide (a.a. 1–20; 0.25, 0.5, 1, 3, and 5 μM) of AcrIIA5.
Bacterium L. Reuteri, supplied by BioGaia Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bacterium l. reuteri/product/BioGaia Inc
Average 90 stars, based on 1 article reviews
bacterium l. reuteri - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
food-grade bacterium l. lactis  (China Pharmaceuticals Inc)
90
China Pharmaceuticals Inc food-grade bacterium l. lactis
Impact of the IDR length and charge on Cas9 inhibition by AcrIIA5. ( A <t>)</t> <t>DNA</t> cleavage assay of S. pyogenes <t>Cas9−sgRNA</t> (0.5 μM) in the presence of AcrIIA4 (3 μM) and AcrIIA5 (0.25, 0.5, 1 and 3 μM). ( B ) Analysis of sgRNA (0.2 μM) cleavage in the presence and absence of Cas9 (0.4 μM), AcrIIA4 (4 μM) and AcrIIA5 (4 μM) on a urea gel. ( C ) DNA cleavage assay of Cas9−sgRNA (0.5 μM) in the presence of AcrIIA5 (1 μM) or AcrIIA5 Δ20 (1 μM). ( D ) Domain constructs of AcrIIA5 with serial truncations (top) and charge mutations of the IDR (middle), and the IDR peptide sequence (bottom). (E−G) DNA cleavage assay of Cas9−sgRNA (0.5 μM) in the presence of ( E ) AcrIIA5 with serial truncations of IDR (3 μM), ( F ) AcrIIA5 with charge mutations of IDR (3 μM), and ( G ) the isolated IDR peptide (a.a. 1–20; 0.25, 0.5, 1, 3, and 5 μM) of AcrIIA5.
Food Grade Bacterium L. Lactis, supplied by China Pharmaceuticals Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/food-grade bacterium l. lactis/product/China Pharmaceuticals Inc
Average 90 stars, based on 1 article reviews
food-grade bacterium l. lactis - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
l. lactis bacterium  (Mobitec Inc)
90
Mobitec Inc l. lactis bacterium
Impact of the IDR length and charge on Cas9 inhibition by AcrIIA5. ( A <t>)</t> <t>DNA</t> cleavage assay of S. pyogenes <t>Cas9−sgRNA</t> (0.5 μM) in the presence of AcrIIA4 (3 μM) and AcrIIA5 (0.25, 0.5, 1 and 3 μM). ( B ) Analysis of sgRNA (0.2 μM) cleavage in the presence and absence of Cas9 (0.4 μM), AcrIIA4 (4 μM) and AcrIIA5 (4 μM) on a urea gel. ( C ) DNA cleavage assay of Cas9−sgRNA (0.5 μM) in the presence of AcrIIA5 (1 μM) or AcrIIA5 Δ20 (1 μM). ( D ) Domain constructs of AcrIIA5 with serial truncations (top) and charge mutations of the IDR (middle), and the IDR peptide sequence (bottom). (E−G) DNA cleavage assay of Cas9−sgRNA (0.5 μM) in the presence of ( E ) AcrIIA5 with serial truncations of IDR (3 μM), ( F ) AcrIIA5 with charge mutations of IDR (3 μM), and ( G ) the isolated IDR peptide (a.a. 1–20; 0.25, 0.5, 1, 3, and 5 μM) of AcrIIA5.
L. Lactis Bacterium, supplied by Mobitec Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/l. lactis bacterium/product/Mobitec Inc
Average 90 stars, based on 1 article reviews
l. lactis bacterium - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
n2-fixing bacterium sinorhizobium meliloti l  (Medicago)
90
Medicago n2-fixing bacterium sinorhizobium meliloti l
Impact of the IDR length and charge on Cas9 inhibition by AcrIIA5. ( A <t>)</t> <t>DNA</t> cleavage assay of S. pyogenes <t>Cas9−sgRNA</t> (0.5 μM) in the presence of AcrIIA4 (3 μM) and AcrIIA5 (0.25, 0.5, 1 and 3 μM). ( B ) Analysis of sgRNA (0.2 μM) cleavage in the presence and absence of Cas9 (0.4 μM), AcrIIA4 (4 μM) and AcrIIA5 (4 μM) on a urea gel. ( C ) DNA cleavage assay of Cas9−sgRNA (0.5 μM) in the presence of AcrIIA5 (1 μM) or AcrIIA5 Δ20 (1 μM). ( D ) Domain constructs of AcrIIA5 with serial truncations (top) and charge mutations of the IDR (middle), and the IDR peptide sequence (bottom). (E−G) DNA cleavage assay of Cas9−sgRNA (0.5 μM) in the presence of ( E ) AcrIIA5 with serial truncations of IDR (3 μM), ( F ) AcrIIA5 with charge mutations of IDR (3 μM), and ( G ) the isolated IDR peptide (a.a. 1–20; 0.25, 0.5, 1, 3, and 5 μM) of AcrIIA5.
N2 Fixing Bacterium Sinorhizobium Meliloti L, supplied by Medicago, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/n2-fixing bacterium sinorhizobium meliloti l/product/Medicago
Average 90 stars, based on 1 article reviews
n2-fixing bacterium sinorhizobium meliloti l - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier
probiotic bacterium l. paracasei ssp. paracasei  (Foerst GmbH)
90
Foerst GmbH probiotic bacterium l. paracasei ssp. paracasei
Impact of the IDR length and charge on Cas9 inhibition by AcrIIA5. ( A <t>)</t> <t>DNA</t> cleavage assay of S. pyogenes <t>Cas9−sgRNA</t> (0.5 μM) in the presence of AcrIIA4 (3 μM) and AcrIIA5 (0.25, 0.5, 1 and 3 μM). ( B ) Analysis of sgRNA (0.2 μM) cleavage in the presence and absence of Cas9 (0.4 μM), AcrIIA4 (4 μM) and AcrIIA5 (4 μM) on a urea gel. ( C ) DNA cleavage assay of Cas9−sgRNA (0.5 μM) in the presence of AcrIIA5 (1 μM) or AcrIIA5 Δ20 (1 μM). ( D ) Domain constructs of AcrIIA5 with serial truncations (top) and charge mutations of the IDR (middle), and the IDR peptide sequence (bottom). (E−G) DNA cleavage assay of Cas9−sgRNA (0.5 μM) in the presence of ( E ) AcrIIA5 with serial truncations of IDR (3 μM), ( F ) AcrIIA5 with charge mutations of IDR (3 μM), and ( G ) the isolated IDR peptide (a.a. 1–20; 0.25, 0.5, 1, 3, and 5 μM) of AcrIIA5.
Probiotic Bacterium L. Paracasei Ssp. Paracasei, supplied by Foerst GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/probiotic bacterium l. paracasei ssp. paracasei/product/Foerst GmbH
Average 90 stars, based on 1 article reviews
probiotic bacterium l. paracasei ssp. paracasei - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

Image Search Results


Impact of the IDR length and charge on Cas9 inhibition by AcrIIA5. ( A ) DNA cleavage assay of S. pyogenes Cas9−sgRNA (0.5 μM) in the presence of AcrIIA4 (3 μM) and AcrIIA5 (0.25, 0.5, 1 and 3 μM). ( B ) Analysis of sgRNA (0.2 μM) cleavage in the presence and absence of Cas9 (0.4 μM), AcrIIA4 (4 μM) and AcrIIA5 (4 μM) on a urea gel. ( C ) DNA cleavage assay of Cas9−sgRNA (0.5 μM) in the presence of AcrIIA5 (1 μM) or AcrIIA5 Δ20 (1 μM). ( D ) Domain constructs of AcrIIA5 with serial truncations (top) and charge mutations of the IDR (middle), and the IDR peptide sequence (bottom). (E−G) DNA cleavage assay of Cas9−sgRNA (0.5 μM) in the presence of ( E ) AcrIIA5 with serial truncations of IDR (3 μM), ( F ) AcrIIA5 with charge mutations of IDR (3 μM), and ( G ) the isolated IDR peptide (a.a. 1–20; 0.25, 0.5, 1, 3, and 5 μM) of AcrIIA5.

Journal: Nucleic Acids Research

Article Title: Intrinsic disorder is essential for Cas9 inhibition of anti-CRISPR AcrIIA5

doi: 10.1093/nar/gkaa512

Figure Lengend Snippet: Impact of the IDR length and charge on Cas9 inhibition by AcrIIA5. ( A ) DNA cleavage assay of S. pyogenes Cas9−sgRNA (0.5 μM) in the presence of AcrIIA4 (3 μM) and AcrIIA5 (0.25, 0.5, 1 and 3 μM). ( B ) Analysis of sgRNA (0.2 μM) cleavage in the presence and absence of Cas9 (0.4 μM), AcrIIA4 (4 μM) and AcrIIA5 (4 μM) on a urea gel. ( C ) DNA cleavage assay of Cas9−sgRNA (0.5 μM) in the presence of AcrIIA5 (1 μM) or AcrIIA5 Δ20 (1 μM). ( D ) Domain constructs of AcrIIA5 with serial truncations (top) and charge mutations of the IDR (middle), and the IDR peptide sequence (bottom). (E−G) DNA cleavage assay of Cas9−sgRNA (0.5 μM) in the presence of ( E ) AcrIIA5 with serial truncations of IDR (3 μM), ( F ) AcrIIA5 with charge mutations of IDR (3 μM), and ( G ) the isolated IDR peptide (a.a. 1–20; 0.25, 0.5, 1, 3, and 5 μM) of AcrIIA5.

Article Snippet: DNA encoding a minimal T7 promoter upstream of an sgRNA of S. pyogenes Cas9 (with a random sequence without targeting sites in E. coli : 5′-GGAAATTAGGTGCGCTTGGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTT-3′) and an sgRNA of L. bacterium Cas12a (with a random sequence without targeting sites in E. coli : 5′- TAATTTCTACTAAGTGTAGATGGAAATTAGGTGCGCTTGGC-3′) was synthesized by Bioneer.

Techniques: Inhibition, DNA Cleavage Assay, Construct, Sequencing, Isolation

Interaction between AcrIIA5 and Cas9–sgRNA via gel shift assay and NMR spectroscopy. Changes in the electrophoretic mobility shift profiles of Cas9–sgRNA (0.2 μM) in the presence of ( A ) AcrIIA5 (0.4, 0.8, 2 and 4 μM), ( B ) AcrIIA5 (4 μM) with serial truncations of IDR, ( C ) AcrIIA5 (4 μM) with positive charge mutations of IDR and ( D ) the isolated IDR peptide (0.4, 0.8, 2 and 4 μM). 2D 1 H– 15 N HSQC spectra of ( E ) 15 N-AcrIIA5 and ( F ) 15 N-AcrIIA5 Δ20 are shown in the absence ( black ) and in the presence ( red ) of Cas9–sgRNA.

Journal: Nucleic Acids Research

Article Title: Intrinsic disorder is essential for Cas9 inhibition of anti-CRISPR AcrIIA5

doi: 10.1093/nar/gkaa512

Figure Lengend Snippet: Interaction between AcrIIA5 and Cas9–sgRNA via gel shift assay and NMR spectroscopy. Changes in the electrophoretic mobility shift profiles of Cas9–sgRNA (0.2 μM) in the presence of ( A ) AcrIIA5 (0.4, 0.8, 2 and 4 μM), ( B ) AcrIIA5 (4 μM) with serial truncations of IDR, ( C ) AcrIIA5 (4 μM) with positive charge mutations of IDR and ( D ) the isolated IDR peptide (0.4, 0.8, 2 and 4 μM). 2D 1 H– 15 N HSQC spectra of ( E ) 15 N-AcrIIA5 and ( F ) 15 N-AcrIIA5 Δ20 are shown in the absence ( black ) and in the presence ( red ) of Cas9–sgRNA.

Article Snippet: DNA encoding a minimal T7 promoter upstream of an sgRNA of S. pyogenes Cas9 (with a random sequence without targeting sites in E. coli : 5′-GGAAATTAGGTGCGCTTGGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTT-3′) and an sgRNA of L. bacterium Cas12a (with a random sequence without targeting sites in E. coli : 5′- TAATTTCTACTAAGTGTAGATGGAAATTAGGTGCGCTTGGC-3′) was synthesized by Bioneer.

Techniques: Gel Shift, Structural Proteomics, Electrophoretic Mobility Shift Assay, Isolation

Electrostatic surface potential of AcrIIA5, and the influence of surface charge mutations on Cas9 inhibition. ( A ) Structure of AcrIIA5 with electrostatic surface potential in a surface representation for the positively- and negatively-charged surface. ( B ) Basic residues ( blue ) and ( C ) acidic residues ( red ) selected for mutagenesis are shown in a space-filling model. DNA cleavage assay of S. pyogenes Cas9−sgRNA (0.5 μM) in the presence of AcrIIA5 mutants (3 μM) for ( D ) basic residues and ( E ) acidic residues. ( F ) Residues that affect the Acr activity of AcrIIA5 in vivo are shown in a space-filling model: Asp50/Asp74 ( orange ), Arg62/Lys88 ( cyan ), and His66/Asn70/His73 ( green ). ( G ) DNA cleavage assay, and (H) gel shift assay of S. pyogenes Cas9−sgRNA against AcrIIA5 mutants.

Journal: Nucleic Acids Research

Article Title: Intrinsic disorder is essential for Cas9 inhibition of anti-CRISPR AcrIIA5

doi: 10.1093/nar/gkaa512

Figure Lengend Snippet: Electrostatic surface potential of AcrIIA5, and the influence of surface charge mutations on Cas9 inhibition. ( A ) Structure of AcrIIA5 with electrostatic surface potential in a surface representation for the positively- and negatively-charged surface. ( B ) Basic residues ( blue ) and ( C ) acidic residues ( red ) selected for mutagenesis are shown in a space-filling model. DNA cleavage assay of S. pyogenes Cas9−sgRNA (0.5 μM) in the presence of AcrIIA5 mutants (3 μM) for ( D ) basic residues and ( E ) acidic residues. ( F ) Residues that affect the Acr activity of AcrIIA5 in vivo are shown in a space-filling model: Asp50/Asp74 ( orange ), Arg62/Lys88 ( cyan ), and His66/Asn70/His73 ( green ). ( G ) DNA cleavage assay, and (H) gel shift assay of S. pyogenes Cas9−sgRNA against AcrIIA5 mutants.

Article Snippet: DNA encoding a minimal T7 promoter upstream of an sgRNA of S. pyogenes Cas9 (with a random sequence without targeting sites in E. coli : 5′-GGAAATTAGGTGCGCTTGGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTT-3′) and an sgRNA of L. bacterium Cas12a (with a random sequence without targeting sites in E. coli : 5′- TAATTTCTACTAAGTGTAGATGGAAATTAGGTGCGCTTGGC-3′) was synthesized by Bioneer.

Techniques: Inhibition, Mutagenesis, DNA Cleavage Assay, Activity Assay, In Vivo, Gel Shift